plasmid pcris pitchv2 smg8 purr ko (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
plasmid pcris pitchv2 smg8 purr ko
Plasmid Pcris Pitchv2 Smg8 Purr Ko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+pcris+pitchv2+smg8+purr+ko/pCRIS-PITChv2-dTAG-Puro+(BRD4)+(Plasmid+%2391796)/pmc12988323-56-2-9
Average 93 stars, based on 29 article reviews
Plasmid Pcris Pitchv2 Smg8 Purr Ko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+pcris+pitchv2+smg8+purr+ko/pCRIS-PITChv2-dTAG-Puro+(BRD4)+(Plasmid+%2391796)/pmc12988323-56-2-9
Average 93 stars, based on 29 article reviews
plasmid pcris pitchv2 smg8 purr ko - by Bioz Stars,
2026-11
93/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: SMG1:SMG8:SMG9-complex integrity supports efficient execution of nonsense-mediated mRNA decay Article Snippet: The plasmid pX330-PITCh_SMG8 is based on pX330-BbsI-PITCh (Addgene plasmid # 127875; was a gift from Peter Kaiser) and contains the SMG8 sgRNA (5′- AGCTTGCGAGACCTTCTAAT -3′); the plasmid pX330-BbsI-PITCh-SMG9 contains the SMG9 sgRNA (5′-CGCTCTATCCCATAGAGTCC-3′), respectively. .. The donor plasmid pCRIS-PITChv2-SMG8_PurR_KO is based on |